Six Minutes
GZM ShowsDiscover the most downloaded family audio drama in history. Eleven-year-old Holiday is pulled from the icy waters of Alaska with no memory of who she is or where she comes from. And when she begins to develop incredible abilities, she’ll soon learn she’s not alone in the world. From Peabody Award-winning Gen-Z Media, creators of The Unexplainable Disappearance of Mars Patel and The Big Fib, Six Mi... more
| Publishes | Weekly | Episodes | 352 | Founded | 8 years ago |
|---|---|---|---|---|---|
| Number of Listeners | Categories | Performing ArtsArtsDramaFiction | |||
Listen to this Podcast
Latest Episodes
The Anders family returns “home” and a glitchy Cybot spills all. Meanwhile, Nowhere might not be as empty as it first seemed.
Do you want to buy the script? https://tinyurl.com/sixminutesscript
Want to listen to music from the show? https://tiny... more
As Season 5 begins, Holiday and Brynleigh find themselves in a void outside of space and time while the Anders family doesn’t seem to remember Holiday ever existed at all.
Do you want to buy the script? https://tinyurl.com/sixminutesscript
Want t... more
In the final episode of Season 4, timelines collide…and the Six MInutes universe might never be the same.
For more great shows and to listen early and ad-free, visit GZMshows.com
SPONSOR SUPPORT:
Support for Six Minutes is brought to us by Acorn... more
In the penultimate episode of Season 4, Holiday attempts to switch River and Sam with Monica and James, but Adam has other plans.
For more great shows and to listen early and ad-free, visit GZMshows.com
SPONSOR SUPPORT:
Support for Six Minutes is ... more
Key Facts
Similar Podcasts
People also subscribe to these shows.
Recent Guests
Host
Reviews
- 😡💝☺️💖LOVE IT
Love love fav character is HOLIDAY AND BRINLIGH .love the podcast fave podcast 😻 it ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️love it so so so so so so so so SO glad that holiday is back I a,so picky about podcasts but u are so lucky I like this I only listen to 8 pods in the whole world 🤣🤣🤣🤣🤣!SIX MINUTES RULES!!!!!!💞💞💞💞💞💖💖💖💖💖💖💖💖💖💖🩷🩷🩷🩷🩷🩷🩷🩷🩷🩷🥹🥹🥹🥹🥹🥹🥹🥹🥹🥹💟💟💟💟💟💟💟💟💟💟💟❤️🧡💛💚🩵💙💜🖤🩶🤍🤎ps:birdie/cccccccaaaaaaatttttt/Rae is wrong at the start of his/he... more
Apple Podcasts5[]K-popRumiHundrix[]
United Kingdom3 days ago - K-pop slay queen
K-pop is so late just so you know PS I really like this show. It’s one of the best things I’ve listened to.
Spot the difference easy🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼♂️🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼. spot the difference, medium.⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️🏐⚾️⚾️⚾️⚾️⚾️⚾️⚾️ spot the difference hard🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🧅🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔
Apple Podcasts5A changed sleep.
United States3 days ago - Eeeeeehhhhhh
Give Casey her own podcast
Apple Podcasts5Podcast lover😍😍😍😍😍😍😍United States4 days ago - Love it
I have listened to every episode ever and sooo many plot twists
BTW if you have finished listen to the unexplaineable disappearance of Mars Patel
Apple Podcasts5Mush0001United Kingdom4 days ago - BESTPODEVERAMAZINGLOVELOVELOVELOVE
I love Six Minutes; great podcast!!! Fine. This does deserve to be in ALL CAPS!!!!!!!!!! LOVE IT!!! Mild kissing, but only if you’re apposed to kissing or something, you might not like it. Still amazing podcast with great, I repeat, GREAT lore. I recommend for sci-fi fans. (Hee hee hee… Sci-fi…) Also, there are spoilers if you scroll down, but first let’s…
Spot the difference:
Easy: 🖐️🖐️🖐️🖐️🖐️🖐️🖐️🖐️🖖🖐️🖐️🖐️ Medium: ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️♥️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️ Hard:👰🏾👰🏾👰�... more
Apple Podcasts5The Mal 2United States4 days ago
Listeners Say
Key themes from listener reviews, highlighting what works and what could be improved about the show.
Chart Rankings
How this podcast ranks in the Apple Podcasts, Spotify and YouTube charts.
Spotify | #50 | United States/Fiction |
Apple Podcasts | #3 | United States/Fiction/Drama |
Apple Podcasts | #9 | United States/Fiction |
Apple Podcasts | #2 |  Canada/Fiction/Drama |
Apple Podcasts | #3 | Canada/Fiction |
Apple Podcasts | #35 | United Kingdom/Fiction/Drama |
Audience Metrics
Listeners, social reach, demographics and more for this podcast.
| Listeners per Episode | Gender Skew | Location | |||
|---|---|---|---|---|---|
| Interests | Professions | Age Range | |||
| Household Income | Social Media Reach | ||||
Frequently Asked Questions About Six Minutes
What is Six Minutes about and what kind of topics does it cover?
Focused on the thrilling adventures of an eleven-year-old girl with mysterious origins, the content features complex narratives entwined with themes of family, identity, and superhuman abilities. Key elements include time travel, memory loss, and emotional struggles as characters navigate their relationships amidst a fantastical backdrop. Each episode engages listeners with suspenseful plots that blend humor and drama, unfolding through a rich tapestry of interconnected storylines that maintain a grip on their attention. The unique storytelling style and captivating twists make it a standout choice for family audiences looking for compelling audio drama.
Where can I find podcast stats for Six Minutes?
Rephonic provides a wide range of podcast stats for Six Minutes. We scanned the web and collated all of the information that we could find in our comprehensive podcast database. See how many people listen to Six Minutes and access YouTube viewership numbers, download stats, audience demographics, chart rankings, ratings, reviews and more.
How many listeners does Six Minutes get?
Rephonic provides a full set of podcast information for three million podcasts, including the number of listeners. View further listenership figures for Six Minutes, including podcast download numbers and subscriber numbers, so you can make better decisions about which podcasts to sponsor or be a guest on. You will need to upgrade your account to access this premium data.
What are the audience demographics for Six Minutes?
Rephonic provides comprehensive predictive audience data for Six Minutes, including gender skew, age, country, political leaning, income, professions, education level, and interests. You can access these listener demographics by upgrading your account.
How many subscribers and views does Six Minutes have?
To see how many followers or subscribers Six Minutes has on Spotify and other platforms such as Castbox and Podcast Addict, simply upgrade your account. You'll also find viewership figures for their YouTube channel if they have one.
Which podcasts are similar to Six Minutes?
These podcasts share a similar audience with Six Minutes:
1. Imagination Amplified
2. Grimm, Grimmer, Grimmest
3. The Big Fib
4. Who, When, Wow!
5. Wow in the World
How many episodes of Six Minutes are there?
Six Minutes launched 8 years ago and published 352 episodes to date. You can find more information about this podcast including rankings, audience demographics and engagement in our podcast database.
How do I contact Six Minutes?
Our systems regularly scour the web to find email addresses and social media links for this podcast. We scanned the web and collated all of the contact information that we could find in our podcast database. But in the unlikely event that you can't find what you're looking for, our concierge service lets you request our research team to source better contacts for you.
Where can I see ratings and reviews for Six Minutes?
Rephonic pulls ratings and reviews for Six Minutes from multiple sources, including Spotify, Apple Podcasts, Castbox, and Podcast Addict.
View all the reviews in one place instead of visiting each platform individually and use this information to decide if a show is worth pitching or not.
How do I access podcast episode transcripts for Six Minutes?
Rephonic provides full transcripts for episodes of Six Minutes. Search within each transcript for your keywords, whether they be topics, brands or people, and figure out if it's worth pitching as a guest or sponsor. You can even set-up alerts to get notified when your keywords are mentioned.
What guests have appeared on Six Minutes?
Recent guests on Six Minutes include:
1. Ryan Reynolds
2. Joe Pasternak
To view more recent guests and their details, simply upgrade your Rephonic account. You'll also get access to a typical guest profile to help you decide if the show is worth pitching.