Six Minutes
GZM ShowsDiscover the most downloaded family audio drama in history. Eleven-year-old Holiday is pulled from the icy waters of Alaska with no memory of who she is or where she comes from. And when she begins to develop incredible abilities, she’ll soon learn she’s not alone in the world.
From Peabody Award-winning Gen-Z Media, creators of The Unexplainable Disappearance of Mars Patel and The Big Fib, Six... more
| Publishes | Weekly | Episodes | 355 | Founded | 8 years ago |
|---|---|---|---|---|---|
| Number of Listeners | Categories | FictionPerforming ArtsDramaArts | |||
Listen to this Podcast
Latest Episodes
Monica and James acknowledge something is missing from their lives, and she’s called to a mysterious meeting at WhittierCorp.
Do you want to buy the script? https://tinyurl.com/sixminutesscript Want to listen to music from the show? https:/... more
The Anders house is saved by an old nemesis as Holiday sees a way to connect.
Do you want to buy the script? https://tinyurl.com/sixminutesscript
Want to listen to music from the show? https://tinyurl.com/sixminutestheme
Looking for offi... more
Casey’s electrical slip-up causes a disaster in the Anders house.
Do you want to buy the script? https://tinyurl.com/sixminutesscript
Want to listen to music from the show? https://tinyurl.com/sixminutestheme
Looking for official Six Minutes... more
As Cyrus gets a glimpse of Brynleigh’s life, she’s brought into his by Monica.
Do you want to buy the script? https://tinyurl.com/sixminutesscript
Want to listen to music from the show? https://tinyurl.com/sixminutestheme
Looking for officia... more
Key Facts
Similar Podcasts
People also subscribe to these shows.
Recent Guests
Reviews
- Don’t read this cause ima half wake
I thought lesbian was a cont try 😅 until I searched it up 🥲😅😅😅 sorry I am half awake
Apple Podcasts5Boba purple
United States20 days ago - This is a great podcast
This is great,good work GZM. 😃
Apple Podcasts5Jackson67Mango67MangoUnited States20 days ago - This is really good
Hi I’m Rae I am a SUPER FAN this show always ends on a cliff hanger GZM shows rule my name is also birdie ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️ but the episodes could be longer
Apple Podcasts5ccccccccaaaaaaatttttt
United Kingdom20 days ago - Best podcast ever!!
Spot the difference🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀☘️🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀🍀 level two 🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🐀🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡🦡
🚨🚨🚨🚨
🚨🚨 spoiler alert🚨🚨
🚨🚨🚨🚨
Smoot 5!!!!!!!!!!!!
\|||/
O
/ | \
/\
Holiday 😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭😭nnnnnnnnnnnnnooooooooooooooooooo
Ps season five= Season one ... more
Apple Podcasts567😈United States20 days ago - Love it sooooooooo much
Best podcast I have ever listened to I listen to the evey night Love plot twist and the cliff hangers
Apple Podcasts5hdidbskendjdidndUnited States21 days ago
Listeners Say
Key themes from listener reviews, highlighting what works and what could be improved about the show.
Chart Rankings
How this podcast ranks in the Apple Podcasts, Spotify and YouTube charts.
Apple Podcasts | #4 | United States/Fiction/Drama |
Apple Podcasts | #8 | United States/Fiction |
Apple Podcasts | #3 |  Canada/Fiction/Drama |
Apple Podcasts | #4 | Canada/Fiction |
Apple Podcasts | #39 | United Kingdom/Fiction/Drama |
Apple Podcasts | #89 | United Kingdom/Fiction |
Audience Metrics
Listeners, social reach, demographics and more for this podcast.
| Listeners per Episode | Gender Skew | Location | |||
|---|---|---|---|---|---|
| Interests | Professions | Age Range | |||
| Household Income | Social Media Reach | ||||
Frequently Asked Questions About Six Minutes
What is Six Minutes about and what kind of topics does it cover?
Centering on the thrilling journey of an eleven-year-old girl named Holiday, the narrative unfolds as she is rescued from icy Alaskan waters, awakening with no memories of her past. As she navigates a world filled with mysterious powers and a range of emotional experiences, the storyline is enriched with themes of identity, friendship, and the bonds that form amidst perilous circumstances. Characters grappling with their unique abilities and the implications of their intertwined fates create engaging plots that keep listeners invested. With cliffhangers and surprises in each episode, the structure of the episodes allows for a captivating family-friendly audio drama experience that resonates with audiences seeking adventure and intrigue.
Where can I find podcast stats for Six Minutes?
Rephonic provides a wide range of podcast stats for Six Minutes. We scanned the web and collated all of the information that we could find in our comprehensive podcast database. See how many people listen to Six Minutes and access YouTube viewership numbers, download stats, audience demographics, chart rankings, ratings, reviews and more.
How many listeners does Six Minutes get?
Rephonic provides a full set of podcast information for three million podcasts, including the number of listeners. View further listenership figures for Six Minutes, including podcast download numbers and subscriber numbers, so you can make better decisions about which podcasts to sponsor or be a guest on. You will need to upgrade your account to access this premium data.
What are the audience demographics for Six Minutes?
Rephonic provides comprehensive predictive audience data for Six Minutes, including gender skew, age, country, political leaning, income, professions, education level, and interests. You can access these listener demographics by upgrading your account.
How many subscribers and views does Six Minutes have?
To see how many followers or subscribers Six Minutes has on Spotify and other platforms such as Castbox and Podcast Addict, simply upgrade your account. You'll also find viewership figures for their YouTube channel if they have one.
Which podcasts are similar to Six Minutes?
These podcasts share a similar audience with Six Minutes:
1. The Unexplainable Disappearance of Mars Patel
2. The Big Fib
3. Grimm, Grimmer, Grimmest
4. Whose Amazing Life?
5. Imagination Amplified
How many episodes of Six Minutes are there?
Six Minutes launched 8 years ago and published 355 episodes to date. You can find more information about this podcast including rankings, audience demographics and engagement in our podcast database.
How do I contact Six Minutes?
Our systems regularly scour the web to find email addresses and social media links for this podcast. We scanned the web and collated all of the contact information that we could find in our podcast database. But in the unlikely event that you can't find what you're looking for, our concierge service lets you request our research team to source better contacts for you.
Where can I see ratings and reviews for Six Minutes?
Rephonic pulls ratings and reviews for Six Minutes from multiple sources, including Spotify, Apple Podcasts, Castbox, and Podcast Addict.
View all the reviews in one place instead of visiting each platform individually and use this information to decide if a show is worth pitching or not.
How do I access podcast episode transcripts for Six Minutes?
Rephonic provides full transcripts for episodes of Six Minutes. Search within each transcript for your keywords, whether they be topics, brands or people, and figure out if it's worth pitching as a guest or sponsor. You can even set-up alerts to get notified when your keywords are mentioned.
What guests have appeared on Six Minutes?
Recent guests on Six Minutes include:
1. Brynleigh Pasternak
2. Ryan Reynolds
3. Joe Pasternak
To view more recent guests and their details, simply upgrade your Rephonic account. You'll also get access to a typical guest profile to help you decide if the show is worth pitching.