Rephonic
Artwork for Six Minutes

Six Minutes

GZM Shows
Time Travel
Jude
Avatar: the Last Airbender
Elixir Academy
Brynleigh Pasternak
Cyrus
Brynleigh
Penn
Avatar the Last Airbender
Carnival
Brinley
Cadence Cavendish
GZM Shows
Holiday Corp
Portals
Holiday
Mila
Adam
Bruce
Katie

Discover the most downloaded family audio drama in history. Eleven-year-old Holiday is pulled from the icy waters of Alaska with no memory of who she is or where she comes from. And when she begins to develop incredible abilities, she’ll soon learn she’s not alone in the world. From Peabody Award-winning Gen-Z Media, creators of The Unexplainable Disappearance of Mars Patel and The Big Fib, Six Mi... more

PublishesWeeklyEpisodes352Founded8 years ago
Number of ListenersCategories
Performing ArtsDramaArtsFiction

Listen to this Podcast

Artwork for Six Minutes

Latest Episodes

Episiode 1 "The Treasure"

When 13-year-old Jonas moves into his late Grandpa’s house, he stumbles upon the mystery of a lost treasure that could be worth millions… and finds himself going head to head with a curse!

Want more? Listen to Episode 2 "T... more

Cyrus rescues Brynleigh from the water, but it's Birdie who discovers a new talent.

Do you want to buy the script? ⁠https://tinyurl.com/sixminutesscript⁠

Want to listen to music from the show? ⁠https://tinyurl.com/sixminutestheme⁠

Looking for offi... more

Brynleigh realizes she’s going to have to leave Nowhere without Holiday.

Do you want to buy the script? ⁠https://tinyurl.com/sixminutesscript⁠

Want to listen to music from the show? ⁠https://tinyurl.com/sixminutestheme⁠

Looking for official Six Mi... more

Jude makes his plea to Brynleigh while Cyrus seeks help from an old friend.

Do you want to buy the script? ⁠https://tinyurl.com/sixminutesscript⁠

Want to listen to music from the show? ⁠https://tinyurl.com/sixminutestheme⁠

Looking for official Six... more

Key Facts

Accepts Sponsors
Contact Information
Podcast Host
Number of Listeners
Find out how many people listen to this podcast per episode and each month.

Similar Podcasts

People also subscribe to these shows.

Recent Guests

Ryan Reynolds
Actor and entrepreneur known for his roles in film and television.
Mint Mobile
Episode: S4 E47: Testing Out a New Power
Joe Pasternak
An individual interested in buying the cabin.
Episode: S4 E39: Out for a Cup of Joe…the Teenage Version

Host

Gen-Z Media Team
Creators and producers behind the audio drama, incorporating a team of writers and producers dedicated to family-friendly narratives. They are known for crafting engaging stories that capture the imagination of young audiences and their families.

Reviews

4.6 out of 5 stars from 26k ratings
  • 😡💝☺️💖LOVE IT

    Love love fav character is HOLIDAY AND BRINLIGH .love the podcast fave podcast 😻 it ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️love it so so so so so so so so SO glad that holiday is back I a,so picky about podcasts but u are so lucky I like this I only listen to 8 pods in the whole world 🤣🤣🤣🤣🤣!SIX MINUTES RULES!!!!!!💞💞💞💞💞💖💖💖💖💖💖💖💖💖💖🩷🩷🩷🩷🩷🩷🩷🩷🩷🩷🥹🥹🥹🥹🥹🥹🥹🥹🥹🥹💟💟💟💟💟💟💟💟💟💟💟❤️🧡💛💚🩵💙💜🖤🩶🤍🤎ps:birdie/cccccccaaaaaaatttttt/Rae is wrong at the start of his/he... more

    Apple Podcasts
    5
    []K-popRumiHundrix[]
    United Kingdom24 days ago
  • K-pop slay queen

    K-pop is so late just so you know PS I really like this show. It’s one of the best things I’ve listened to.

    Spot the difference easy🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼‍♂️🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼. spot the difference, medium.⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️🏐⚾️⚾️⚾️⚾️⚾️⚾️⚾️ spot the difference hard🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🧅🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔

    Apple Podcasts
    5
    A changed sleep.
    United States24 days ago
  • Eeeeeehhhhhh

    Give Casey her own podcast

    Apple Podcasts
    5
    Podcast lover😍😍😍😍😍😍😍
    United States24 days ago
  • Love it

    I have listened to every episode ever and sooo many plot twists

    BTW if you have finished listen to the unexplaineable disappearance of Mars Patel

    Apple Podcasts
    5
    Mush0001
    United Kingdom24 days ago
  • BESTPODEVERAMAZINGLOVELOVELOVELOVE

    I love Six Minutes; great podcast!!! Fine. This does deserve to be in ALL CAPS!!!!!!!!!! LOVE IT!!! Mild kissing, but only if you’re apposed to kissing or something, you might not like it. Still amazing podcast with great, I repeat, GREAT lore. I recommend for sci-fi fans. (Hee hee hee… Sci-fi…) Also, there are spoilers if you scroll down, but first let’s…

    Spot the difference:

    Easy: 🖐️🖐️🖐️🖐️🖐️🖐️🖐️🖐️🖖🖐️🖐️🖐️ Medium: ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️♥️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️ Hard:👰🏾👰🏾👰�... more

    Apple Podcasts
    5
    The Mal 2
    United States24 days ago

Listeners Say

Key themes from listener reviews, highlighting what works and what could be improved about the show.

Many reviews highlight the emotional depth and the relatable struggles of the characters, which resonate well with the audience.
Listeners express strong enthusiasm for the story's twists and engaging characters.
The podcast is praised for its family-friendly themes, appealing to a wide age range.

Chart Rankings

How this podcast ranks in the Apple Podcasts, Spotify and YouTube charts.

Spotify
#49
United States/Fiction
Apple Podcasts
#3
United States/Fiction/Drama
Apple Podcasts
#9
United States/Fiction
Apple Podcasts
#226
Canada/Top Podcasts
Apple Podcasts
#2
Canada/Fiction/Drama
Apple Podcasts
#2
Canada/Fiction

Audience Metrics

Listeners, social reach, demographics and more for this podcast.

Listeners per EpisodeGender SkewLocation
InterestsProfessionsAge Range
Household IncomeSocial Media Reach

Frequently Asked Questions About Six Minutes

What is Six Minutes about and what kind of topics does it cover?

Focused on the thrilling adventures of an eleven-year-old girl with mysterious origins, the content features complex narratives entwined with themes of family, identity, and superhuman abilities. Key elements include time travel, memory loss, and emotional struggles as characters navigate their relationships amidst a fantastical backdrop. Each episode engages listeners with suspenseful plots that blend humor and drama, unfolding through a rich tapestry of interconnected storylines that maintain a grip on their attention. The unique storytelling style and captivating twists make it a standout choice for family audiences looking for compelling audio drama.

Where can I find podcast stats for Six Minutes?

Rephonic provides a wide range of podcast stats for Six Minutes. We scanned the web and collated all of the information that we could find in our comprehensive podcast database. See how many people listen to Six Minutes and access YouTube viewership numbers, download stats, audience demographics, chart rankings, ratings, reviews and more.

How many listeners does Six Minutes get?

Rephonic provides a full set of podcast information for three million podcasts, including the number of listeners. View further listenership figures for Six Minutes, including podcast download numbers and subscriber numbers, so you can make better decisions about which podcasts to sponsor or be a guest on. You will need to upgrade your account to access this premium data.

What are the audience demographics for Six Minutes?

Rephonic provides comprehensive predictive audience data for Six Minutes, including gender skew, age, country, political leaning, income, professions, education level, and interests. You can access these listener demographics by upgrading your account.

How many subscribers and views does Six Minutes have?

To see how many followers or subscribers Six Minutes has on Spotify and other platforms such as Castbox and Podcast Addict, simply upgrade your account. You'll also find viewership figures for their YouTube channel if they have one.

Which podcasts are similar to Six Minutes?

These podcasts share a similar audience with Six Minutes:

1. Imagination Amplified
2. The Unexplainable Disappearance of Mars Patel
3. The Hollow
4. The Big Fib
5. Grimm, Grimmer, Grimmest

How many episodes of Six Minutes are there?

Six Minutes launched 8 years ago and published 352 episodes to date. You can find more information about this podcast including rankings, audience demographics and engagement in our podcast database.

How do I contact Six Minutes?

Our systems regularly scour the web to find email addresses and social media links for this podcast. We scanned the web and collated all of the contact information that we could find in our podcast database. But in the unlikely event that you can't find what you're looking for, our concierge service lets you request our research team to source better contacts for you.

Where can I see ratings and reviews for Six Minutes?

Rephonic pulls ratings and reviews for Six Minutes from multiple sources, including Spotify, Apple Podcasts, Castbox, and Podcast Addict.

View all the reviews in one place instead of visiting each platform individually and use this information to decide if a show is worth pitching or not.

How do I access podcast episode transcripts for Six Minutes?

Rephonic provides full transcripts for episodes of Six Minutes. Search within each transcript for your keywords, whether they be topics, brands or people, and figure out if it's worth pitching as a guest or sponsor. You can even set-up alerts to get notified when your keywords are mentioned.

What guests have appeared on Six Minutes?

Recent guests on Six Minutes include:

1. Ryan Reynolds
2. Joe Pasternak

To view more recent guests and their details, simply upgrade your Rephonic account. You'll also get access to a typical guest profile to help you decide if the show is worth pitching.

Find and pitch the right podcasts

We help savvy brands, marketers and PR professionals to find the right podcasts for any topic or niche. Get the data and contacts you need to pitch podcasts at scale and turn listeners into customers.
Try it free for 7 days