
Discover the most downloaded family audio drama in history. Eleven-year-old Holiday is pulled from the icy waters of Alaska with no memory of who she is or where she comes from. And when she begins to develop incredible abilities, she’ll soon learn she’s not alone in the world. From Peabody Award-winning Gen-Z Media, creators of The Unexplainable Disappearance of Mars Patel and The Big Fib, Six Mi... more
| Publishes | Weekly | Episodes | 353 | Founded | 8 years ago |
|---|---|---|---|---|---|
| Number of Listeners | Categories | FictionPerforming ArtsDramaArts | |||

As Cyrus gets a glimpse of Brynleigh’s life, she’s brought into his by Monica.
Do you want to buy the script? https://tinyurl.com/sixminutesscript Want to listen to music from the show? https://tinyurl.com/sixminutestheme Looking for official Si... more
When Cybot disappears, he returns with a message…from another place and time.
Do you want to buy the script? https://tinyurl.com/sixminutesscript
Want to listen to music from the show? https://tinyurl.com/sixminutestheme
Looking for official S... more
Cyrus and Brynleigh are interrogated by a mysterious person.
Do you want to buy the script? https://tinyurl.com/sixminutesscript
Want to listen to music from the show? https://tinyurl.com/sixminutestheme
Looking for official Six Minutes merch?... more
Episiode 1 "The Treasure"
When 13-year-old Jonas moves into his late Grandpa’s house, he stumbles upon the mystery of a lost treasure that could be worth millions… and finds himself going head to head with a curse!
Want more? Listen to Episode 2 "T... more
People also subscribe to these shows.
Love love fav character is HOLIDAY AND BRINLIGH .love the podcast fave podcast 😻 it ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️love it so so so so so so so so SO glad that holiday is back I a,so picky about podcasts but u are so lucky I like this I only listen to 8 pods in the whole world 🤣🤣🤣🤣🤣!SIX MINUTES RULES!!!!!!💞💞💞💞💞💖💖💖💖💖💖💖💖💖💖🩷🩷🩷🩷🩷🩷🩷🩷🩷🩷🥹🥹🥹🥹🥹🥹🥹🥹🥹🥹💟💟💟💟💟💟💟💟💟💟💟❤️🧡💛💚🩵💙💜🖤🩶🤍🤎ps:birdie/cccccccaaaaaaatttttt/Rae is wrong at the start of his/he... more
K-pop is so late just so you know PS I really like this show. It’s one of the best things I’ve listened to.
Spot the difference easy🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼♂️🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼🤼. spot the difference, medium.⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️⚾️🏐⚾️⚾️⚾️⚾️⚾️⚾️⚾️ spot the difference hard🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🧅🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔🥔
Give Casey her own podcast
I have listened to every episode ever and sooo many plot twists
BTW if you have finished listen to the unexplaineable disappearance of Mars Patel
I love Six Minutes; great podcast!!! Fine. This does deserve to be in ALL CAPS!!!!!!!!!! LOVE IT!!! Mild kissing, but only if you’re apposed to kissing or something, you might not like it. Still amazing podcast with great, I repeat, GREAT lore. I recommend for sci-fi fans. (Hee hee hee… Sci-fi…) Also, there are spoilers if you scroll down, but first let’s…
Spot the difference:
Easy: 🖐️🖐️🖐️🖐️🖐️🖐️🖐️🖐️🖖🖐️🖐️🖐️ Medium: ❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️♥️❤️❤️❤️❤️❤️❤️❤️❤️❤️❤️ Hard:👰🏾👰🏾👰�... more
Key themes from listener reviews, highlighting what works and what could be improved about the show.
How this podcast ranks in the Apple Podcasts, Spotify and YouTube charts.
Spotify | #47 | |
Apple Podcasts | #3 | |
Apple Podcasts | #8 | |
Apple Podcasts | #3 | |
Apple Podcasts | #3 | |
Apple Podcasts | #56 |
Listeners, social reach, demographics and more for this podcast.
| Listeners per Episode | Gender Skew | Location | |||
|---|---|---|---|---|---|
| Interests | Professions | Age Range | |||
| Household Income | Social Media Reach | ||||
Focused on the thrilling adventures of an eleven-year-old girl with mysterious origins, the content features complex narratives entwined with themes of family, identity, and superhuman abilities. Key elements include time travel, memory loss, and emotional struggles as characters navigate their relationships amidst a fantastical backdrop. Each episode engages listeners with suspenseful plots that blend humor and drama, unfolding through a rich tapestry of interconnected storylines that maintain a grip on their attention. The unique storytelling style and captivating twists make it a standout choice for family audiences looking for compelling audio drama.
Rephonic provides a wide range of podcast stats for Six Minutes. We scanned the web and collated all of the information that we could find in our comprehensive podcast database. See how many people listen to Six Minutes and access YouTube viewership numbers, download stats, audience demographics, chart rankings, ratings, reviews and more.
Rephonic provides a full set of podcast information for three million podcasts, including the number of listeners. View further listenership figures for Six Minutes, including podcast download numbers and subscriber numbers, so you can make better decisions about which podcasts to sponsor or be a guest on. You will need to upgrade your account to access this premium data.
Rephonic provides comprehensive predictive audience data for Six Minutes, including gender skew, age, country, political leaning, income, professions, education level, and interests. You can access these listener demographics by upgrading your account.
To see how many followers or subscribers Six Minutes has on Spotify and other platforms such as Castbox and Podcast Addict, simply upgrade your account. You'll also find viewership figures for their YouTube channel if they have one.
These podcasts share a similar audience with Six Minutes:
1. Imagination Amplified
2. The Unexplainable Disappearance of Mars Patel
3. The Big Fib
4. Dogood Detectives
5. Grimm, Grimmer, Grimmest
Six Minutes launched 8 years ago and published 353 episodes to date. You can find more information about this podcast including rankings, audience demographics and engagement in our podcast database.
Our systems regularly scour the web to find email addresses and social media links for this podcast. We scanned the web and collated all of the contact information that we could find in our podcast database. But in the unlikely event that you can't find what you're looking for, our concierge service lets you request our research team to source better contacts for you.
Rephonic pulls ratings and reviews for Six Minutes from multiple sources, including Spotify, Apple Podcasts, Castbox, and Podcast Addict.
View all the reviews in one place instead of visiting each platform individually and use this information to decide if a show is worth pitching or not.
Rephonic provides full transcripts for episodes of Six Minutes. Search within each transcript for your keywords, whether they be topics, brands or people, and figure out if it's worth pitching as a guest or sponsor. You can even set-up alerts to get notified when your keywords are mentioned.
Recent guests on Six Minutes include:
1. Ryan Reynolds
2. Joe Pasternak
To view more recent guests and their details, simply upgrade your Rephonic account. You'll also get access to a typical guest profile to help you decide if the show is worth pitching.