Rephonic
Artwork for ZDFzoom

ZDFzoom (VIDEO)

ZDFde
PublishesMonthlyEpisodes25Founded9 years ago
Language
German
Category
TV & Film

Listen to this Podcast

Artwork for ZDFzoom

Latest Episodes

Nach Millionenverlusten durch die Greensill-Pleite werfen viele Anleger der Bankenaufsicht Versäumnisse vor. Die BaFin wehrt sich und weist das zurück. Wer ist schuld am Bankenskandal?

#wieunscoronaspaltet

Wer sich in Deutschland gegen den türkischen Staatspräsidenten stellt, muss mit gefährlichen Konsequenzen rechnen. Wie weit gehen Erdoğan und seine Gefolgsleute?

Es ist Krieg in Europa. Russland hat die Ukraine überfallen. Seitdem ist nichts mehr so, wie es einmal war. Die NATO rüstet auf, Russland droht – was wird aus Europa?

Key Facts

Contact Information
Podcast Host

Similar Podcasts

People also subscribe to these shows.

Reviews

3.8 out of 5 stars from 92 ratings
  • 🤮

    Ich kapier die Leute nicht die sagen das der Podcast Eine gute Bildqualität hat die ist ja genauso schlecht wie die von meiner Uroma und komplett langweilig

    Apple Podcasts
    1
    Shadowpro97
    Germanya year ago
  • Wo sind die neuen Folgen???

    Bitte gebt doch mal jede Woche mal ne Folge dann kassiert der Podcast 5 Sterne ⭐️

    Apple Podcasts
    4
    👍😊😅🤣😁😀☺️
    Germanya year ago
  • WANN ???

    Wann erschienen neue folgen, sonst würde ich mein Abo deaktivieren, wenn nix kommt... ?!?

    Apple Podcasts
    4
    Sline7
    Germany2 years ago
  • Waaaaaaaaannnnnnnnnnnn???

    Wann kommen endlich neue Folgen???Es gibt seid dem 14.Oktober.22 keine einzige neue Folge!😧😧😧Wären neue Folgen gekommen wären es⭐️⭐️⭐️⭐️⭐️.

    😢😢😢😢😢😟😢😢😢😢😢😢😢😢😭😭😭😭😭😭😭😭😭😭😭😭😭😭😩😩😩😩😩😩😩😩😩😩😩😩😩😩😫😫😫😫😫😫😫😫😫😫😫😫😫😫

    Apple Podcasts
    5
    gagagagagagagagagugu
    Germany3 years ago
  • Einfach top!

    Richtig super 🙌 hoffe es kommen auch noch neuere Folgen so wie beim Quarks Podcast 👍 ich kann es nur jedem empfehlen, da es sehr ansprechende Themen gibt 👌

    Apple Podcasts
    5
    keine Information SORRY
    Austria4 years ago

Chart Rankings

How this podcast ranks in the Apple Podcasts, Spotify and YouTube charts.

Apple Podcasts
#133
Austria/TV & Film

Audience Metrics

Listeners, social reach, demographics and more for this podcast.

Gender SkewLocationInterests
ProfessionsAge RangeHousehold Income
Social Media Reach

Frequently Asked Questions About ZDFzoom

Where can I find podcast stats for ZDFzoom?

Rephonic provides a wide range of podcast stats for ZDFzoom. We scanned the web and collated all of the information that we could find in our comprehensive podcast database. See how many people listen to ZDFzoom and access YouTube viewership numbers, download stats, audience demographics, chart rankings, ratings, reviews and more.

How many listeners does ZDFzoom get?

Rephonic provides a full set of podcast information for three million podcasts, including the number of listeners. View further listenership figures for ZDFzoom, including podcast download numbers and subscriber numbers, so you can make better decisions about which podcasts to sponsor or be a guest on. You will need to upgrade your account to access this premium data.

What are the audience demographics for ZDFzoom?

Rephonic provides comprehensive predictive audience data for ZDFzoom, including gender skew, age, country, political leaning, income, professions, education level, and interests. You can access these listener demographics by upgrading your account.

How many subscribers and views does ZDFzoom have?

To see how many followers or subscribers ZDFzoom has on Spotify and other platforms such as Castbox and Podcast Addict, simply upgrade your account. You'll also find viewership figures for their YouTube channel if they have one.

Which podcasts are similar to ZDFzoom?

These podcasts share a similar audience with ZDFzoom:

1. heute journal (VIDEO)
2. logo!-Nachrichten (VIDEO)
3. extra 3

How many episodes of ZDFzoom are there?

ZDFzoom launched 9 years ago and published 25 episodes to date. You can find more information about this podcast including rankings, audience demographics and engagement in our podcast database.

How do I contact ZDFzoom?

Our systems regularly scour the web to find email addresses and social media links for this podcast. We scanned the web and collated all of the contact information that we could find in our podcast database. But in the unlikely event that you can't find what you're looking for, our concierge service lets you request our research team to source better contacts for you.

Where can I see ratings and reviews for ZDFzoom?

Rephonic pulls ratings and reviews for ZDFzoom from multiple sources, including Spotify, Apple Podcasts, Castbox, and Podcast Addict.

View all the reviews in one place instead of visiting each platform individually and use this information to decide if a show is worth pitching or not.

How do I access podcast episode transcripts for ZDFzoom?

Rephonic provides full transcripts for episodes of ZDFzoom. Search within each transcript for your keywords, whether they be topics, brands or people, and figure out if it's worth pitching as a guest or sponsor. You can even set-up alerts to get notified when your keywords are mentioned.

Find and pitch the right podcasts

We help savvy brands, marketers and PR professionals to find the right podcasts for any topic or niche. Get the data and contacts you need to pitch podcasts at scale and turn listeners into customers.
Try it free for 7 days