Rephonic
Artwork for Melon's House Party

Melon's House Party

Audible
Christmas
Fairy Tales
Whoville
Hip-Hop
Anxiety
Restaurant Critic
Jonas Brothers
Tis the Grinch Holiday Podcast
Jon Hamm
Brittany Broski
Danny Devito
Lil Chicken
Wondery
Broadway
Grinch
Podcasts
Holiday Podcast

Welcome to Melon’s House Party! Did you know that the objects in your house sing and speak all day long? They just do so in a key only dogs can hear. Enter, Melon, an eight pound dog with a thousand pound heart who is the key to a world that lives right under our noses! She lives in a world full of friends; an always singing record player, a soulless computer, her bookshelf therapist and many more... more

PublishesWeeklyEpisodes52Founded5 years ago
Categories
Kids & FamilyStories for Kids

Listen to this Podcast

Artwork for Melon's House Party

Latest Episodes

Grinch is back and jollier than NEVER! Whoville’s sassiest late-night talk show host returns for season 3 with more sharp-tongued monologues about everything nipping at his nose this holiday season, his signature brand of merry mischief, and a fete o... more

Lil’ Chicken has a restaurant that everybody loves! It’s known for two things: tasty corn nuggets and a stressed-out owner who worries and frets over every little thing. Business is booming, but it always seems like the sky is falling! Join DJ Fyutch... more

Cuddly as a cactus and charming as an eel, Whoville's favorite talk show host is back on the mic! The Grinch may hate the holidays, but he loves his new celebrity status as a chart-topping podcaster. With Cindy Lou and Max by his side, join The Grinc... more

Wow in the World is the #1 science podcast for kids and their grown-ups. Hosts Mindy Thomas and Guy Raz share stories about the latest news in science, technology, and innovation. Stories that give kids hope, agency and make us all say "WOW"!

New ep... more

Key Facts

Accepts Guests
Contact Information
Podcast Host

Similar Podcasts

People also subscribe to these shows.

WeWow
WeWowTinkercast
Flip and Mozi
Flip and MoziTinkercast
Who, When, Wow!
Who, When, Wow!Tinkercast

Recent Guests

Jon Hamm
Actor and guest star
Episode: Listen Now: 'Tis The Grinch Holiday Podcast
Brittany Broski
Social media personality and guest star
Episode: Listen Now: 'Tis The Grinch Holiday Podcast
Danny DeVito
Actor and guest star
Episode: Listen Now: 'Tis The Grinch Holiday Podcast

Reviews

4.4 out of 5 stars from 3k ratings
  • Nice

    It’s great and I’m ten I’m not really a fan though if it makes any sense because Reada record is in Like every song

    Apple Podcasts
    4
    ccccccccaaaaaaatttttt
    United Kingdom3 months ago
  • Please make season three

    Can you please make a season three

    Apple Podcasts
    5
    ISLA!!!!!!
    Canada4 months ago
  • I Love Melon

    I like the songs and I don’t want anyone to die I’m only 10 but if you hate this podcast you should stop listening to it but I Love Melon Mittens and Georgette but I can’t understand how Rita is in every song and Jax should sing!

    Apple Podcasts
    5
    10 years of cool
    United States4 months ago
  • brainrot

    🐶💵 money money pugy

    🐱🦐 trippy tropy

    🏀🚲 chiklatera bicikkatera

    Apple Podcasts
    3
    스웨기 브로드
    United States4 months ago
  • Bookturtle2015

    Sorry, Bookturtle2015, it may seem like I’m stalking you. Buuuuuut maybe you’ve seen me in reviews for Greeking Out and My Brand New Bonus Mum? (Used to be Wise Girl 🦉🏛️)

    Apple Podcasts
    5
    ✨Avery_Cullen✨
    United States4 months ago

Chart Rankings

How this podcast ranks in the Apple Podcasts, Spotify and YouTube charts.

Audience Metrics

Listeners, social reach, demographics and more for this podcast.

Gender SkewLocationInterests
ProfessionsAge RangeHousehold Income
Social Media Reach

Frequently Asked Questions About Melon's House Party

Where can I find podcast stats for Melon's House Party?

Rephonic provides a wide range of podcast stats for Melon's House Party. We scanned the web and collated all of the information that we could find in our comprehensive podcast database. See how many people listen to Melon's House Party and access YouTube viewership numbers, download stats, audience demographics, chart rankings, ratings, reviews and more.

How many listeners does Melon's House Party get?

Rephonic provides a full set of podcast information for three million podcasts, including the number of listeners. View further listenership figures for Melon's House Party, including podcast download numbers and subscriber numbers, so you can make better decisions about which podcasts to sponsor or be a guest on. You will need to upgrade your account to access this premium data.

What are the audience demographics for Melon's House Party?

Rephonic provides comprehensive predictive audience data for Melon's House Party, including gender skew, age, country, political leaning, income, professions, education level, and interests. You can access these listener demographics by upgrading your account.

How many subscribers and views does Melon's House Party have?

To see how many followers or subscribers Melon's House Party has on Spotify and other platforms such as Castbox and Podcast Addict, simply upgrade your account. You'll also find viewership figures for their YouTube channel if they have one.

Which podcasts are similar to Melon's House Party?

These podcasts share a similar audience with Melon's House Party:

1. WeWow
2. Flip and Mozi
3. Wow in the World
4. Who, When, Wow!
5. Snoop and Sniffy: Dog Detective Stories for Kids

How many episodes of Melon's House Party are there?

Melon's House Party launched 5 years ago and published 52 episodes to date. You can find more information about this podcast including rankings, audience demographics and engagement in our podcast database.

How do I contact Melon's House Party?

Our systems regularly scour the web to find email addresses and social media links for this podcast. We scanned the web and collated all of the contact information that we could find in our podcast database. But in the unlikely event that you can't find what you're looking for, our concierge service lets you request our research team to source better contacts for you.

Where can I see ratings and reviews for Melon's House Party?

Rephonic pulls ratings and reviews for Melon's House Party from multiple sources, including Spotify, Apple Podcasts, Castbox, and Podcast Addict.

View all the reviews in one place instead of visiting each platform individually and use this information to decide if a show is worth pitching or not.

How do I access podcast episode transcripts for Melon's House Party?

Rephonic provides full transcripts for episodes of Melon's House Party. Search within each transcript for your keywords, whether they be topics, brands or people, and figure out if it's worth pitching as a guest or sponsor. You can even set-up alerts to get notified when your keywords are mentioned.

What guests have appeared on Melon's House Party?

Recent guests on Melon's House Party include:

1. Jon Hamm
2. Brittany Broski
3. Danny DeVito

To view more recent guests and their details, simply upgrade your Rephonic account. You'll also get access to a typical guest profile to help you decide if the show is worth pitching.

Find and pitch the right podcasts

We help savvy brands, marketers and PR professionals to find the right podcasts for any topic or niche. Get the data and contacts you need to pitch podcasts at scale and turn listeners into customers.
Try it free for 7 days